{-# LANGUAGE ScopedTypeVariables #-} {-# OPTIONS_GHC -fno-warn-missing-signatures #-} import Test.Framework import Test.Framework.Providers.HUnit import Test.Framework.Providers.QuickCheck2 (testProperty) import Data.Monoid (mempty) import Test.HUnit import Test.QuickCheck import Data.Char (toLower) import qualified ADP.Tests.RGExample as RG import qualified ADP.Tests.RGExampleDim2 as RGDim2 import qualified ADP.Tests.RGExampleStar as RGStar import qualified ADP.Tests.CopyExample as Copy import qualified ADP.Tests.CopyTwoTrackExample as CopyTT import qualified MCFG.MCFG as MCFG import qualified ADP.Tests.NestedExample as Nested import qualified ADP.Tests.OneStructureExample as One import qualified ADP.Tests.ZeroStructureTwoBackbonesExample as ZeroTT import ADP.Multi.Rewriting.Tests.YieldSize main :: IO () main = defaultMainWithOpts [ testGroup "Property tests" [ testGroup "Yield size" [ testProperty "map size" prop_yieldSizeMapSize, testProperty "map elements" prop_yieldSizeMapElements, testProperty "yield size" prop_yieldSizeDim2 ] ], testGroup "System tests" [ testCase "finds all reference structures" testRgSimpleCompleteness, --testCase "finds pseudoknot reference structure" testRgRealPseudoknot, testCase "tests associative function with max basepairs" testRgSimpleBasepairs, testProperty "produces copy language" prop_copyLanguage, testProperty "produces same derivation trees for copy language grammar" prop_copyLanguageDerivation, testProperty "produces copy language (two track)" prop_copyLanguageTT, testProperty "produces nested rna" prop_nestedRna, testProperty "produces 1-structure rna" prop_oneStructureRna, testProperty "produces RG rna" prop_rgRna, testProperty "produces RG (dim2) rna" prop_rgDim2Rna, testProperty "produces RG (star version) rna" prop_rgStarRna, testProperty "produces 0-structure over two backbones rna" prop_zeroStructureTwoBackbonesRna ] ] mempty { ropt_test_options = Just mempty { topt_maximum_generated_tests = Just 100 } } rg :: RG.RG_Algebra Char answer -> String -> [answer] rg = RG.rgknot rgDim2 :: RGDim2.RG_Algebra Char answer -> String -> [answer] rgDim2 = RGDim2.rgknot rgStar :: RGStar.RG_Algebra Char answer -> String -> [answer] rgStar = RGStar.rgknot -- https://github.com/neothemachine/rna/wiki/Example testRgSimpleCompleteness = let inp = "agcgu" referenceStructures = [ ".....", ".()..", "...()", "..().", ".()()", ".(..)", ".(())", "(...)", "(().)", "(.())" ] result = rg RG.prettyprint inp in do length result @?= length referenceStructures all (\ ([structure],_) -> structure `elem` referenceStructures) result @? "reference structure not found" -- https://github.com/neothemachine/rna/wiki/Example testRgSimpleBasepairs = let inp = "agcgu" [maxBasepairs] = rg RG.maxBasepairs inp in maxBasepairs @?= 2 -- http://www.ekevanbatenburg.nl/PKBASE/PKB00279.HTML -- This test runs quite long and should only be run manually if needed. testRgRealPseudoknot = let inp = map toLower "CAAUUUUCUGAAAAUUUUCAC" referenceStructure = ".(((((..[[[))))).]]]." referenceStructure2 = ".[[[[[..(((]]]]].)))." result = rg RG.prettyprint inp in any (\ ([structure],_) -> structure == referenceStructure || structure == referenceStructure2) result @? "reference structure not found" smallTestSize prop = sized $ \n -> resize (round (sqrt (fromIntegral n))) prop prop_copyLanguage (CopyLangString w) = let result = Copy.copyGr Copy.prettyprint (w ++ w) in result == [w ++ w] prop_copyLanguageTT (CopyLangString w) = let result = CopyTT.copyTTGr CopyTT.prettyprint (w,w) in result == [(w,w)] -- this basically checks if the yield parser of adp-multi produces the same derivation trees -- as the MCFG parser by Johannes Waldmann -- Note: the copy language grammar is unambiguous! thus, ambiguous grammars (=multiple trees) are not tested here prop_copyLanguageDerivation (CopyLangString w) = let [resultADP] = Copy.copyGr Copy.derivation (w ++ w) [resultMCFG] = MCFG.parse Copy.mcfg (map MCFG.T (w ++ w)) in MCFG.consistent resultMCFG && equivalentTrees resultADP resultMCFG -- checks if two derivation trees are the same (same rules applied) equivalentTrees :: MCFG.Derivation -> MCFG.Derivation -> Bool equivalentTrees t1 t2 = let MCFG.Derivation _ rule1 children1 = t1 MCFG.Derivation _ rule2 children2 = t2 children = zip children1 children2 in rule1 == rule2 && length children1 == length children2 && all (\(c1,c2) -> equivalentTrees c1 c2) children prop_nestedRna (RNAString w) = let results = Nested.nested Nested.prettyprint w in not (null results) && all (\(_,result) -> result == w) results prop_oneStructureRna (RNAString w) = let results = One.oneStructure One.prettyprint2 w in not (null results) && all (\[result] -> result == w) results prop_rgRna (RNAString w) = let results = rg RG.prettyprint w in not (null results) && all (\(_,[result]) -> result == w) results prop_rgDim2Rna (RNAString w) = let results = rgDim2 RGDim2.prettyprint w resultsDim1 = rg RG.prettyprint w in results == resultsDim1 prop_rgStarRna (RNAString w) = let results = rgStar RGStar.prettyprint w resultsRef = rg RG.prettyprint w in results == resultsRef -- This test is a bit useless, it just shows that "something" happens. -- TODO: as in the other tests, we would need a pretty-printing algebra prop_zeroStructureTwoBackbonesRna (RNAString w) = let results = ZeroTT.zeroStructureTwoBackbones ZeroTT.enum (w,w) in not (null results) newtype CopyLangString = CopyLangString String deriving (Show) instance Arbitrary CopyLangString where arbitrary = genAlphabetString CopyLangString "ab" newtype RNAString = RNAString String deriving (Show) instance Arbitrary RNAString where arbitrary = genAlphabetString RNAString "agcu" -- returns a small test string consisting of letters from an alphabet genAlphabetString typ alph = sized $ \n -> do s <- mapM (\_ -> elements alph) [0..round (sqrt (fromIntegral n))] return $ typ s