# HyraxBio AB1 parser, writer and generator (beta 0.2) This project contains - Modules for parsing, generating or manipulating AB1 files. - Support for generating a minimal AB1 file from a FASTA input file - A simple terminal app to perform these operations See - https://hackage.haskell.org/package/hyraxAbif for the hackage documentation - http://www6.appliedbiosystems.com/support/software_community/ABIF_File_Format.pdf for a high level overview of the AB1 file format. # Building Build with one of - `stack build` or (`make build`) - `cabal new-build` # Terminal app Run with - `stack exec hyraxAbif-exe -- -- dump` if you are using stack - `cabal new-run hyraxAbif-exe dump` if you are using cabal 2.x ## Dump AB1 To dump an existing AB1 run `hyraxAbif-exe dump example.ab1` This will output the structure of the AB1 like this ``` Header { hName = "ABIF" , hVersion = 101 } Directory { dTagName = "tdir" , dTagNum = 1 , dElemTypeCode = 1023 , dElemTypeDesc = "root" , dElemType = ElemRoot , dElemSize = 28 , dElemNum = 13 , dDataSize = 364 , dDataOffset = 61980 , dData = "" , dDataDebug = [] } [ Directory { dTagName = "DATA" , dTagNum = 9 , dElemTypeCode = 4 , dElemTypeDesc = "short" , dElemType = ElemShort , dElemSize = 2 , dElemNum = 7440 , dDataSize = 14880 , dDataOffset = 128 , dData = "" , dDataDebug = [] } . . . DATA {short} tagNum=9 size=2 count=7440 offset=128 [] DATA {short} tagNum=10 size=2 count=7440 offset=15008 [] DATA {short} tagNum=11 size=2 count=7440 offset=29888 [] DATA {short} tagNum=12 size=2 count=7440 offset=44768 [] FWO_ {char} tagNum=1 size=1 count=4 offset=1195463747 ["GATC"] LANE {short} tagNum=1 size=2 count=1 offset=65536 ["1"] PBAS {char} tagNum=1 size=1 count=744 offset=59648 ["GGGGGCAACTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAGTTTGCCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAGATACTCATAGAAATCTGTGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGATTGGTTGCACTTTAAATTTTCCCATTAGCCCTATTGAGACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAGATGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAATTAGGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATGAAGACTTCAGGAAGTATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGA"] PDMF {pString} tagNum=1 size=1 count=23 offset=60392 ["KB_3500_POP7_BDTv3.mob"] PDMF {pString} tagNum=2 size=1 count=23 offset=60415 ["KB_3500_POP7_BDTv3.mob"] PLOC {short} tagNum=1 size=2 count=744 offset=60438 [] S/N% {short} tagNum=1 size=2 count=4 offset=61926 [] SMPL {pString} tagNum=1 size=1 count=10 offset=61934 ["S17-SeqF1"] CMNT {pString} tagNum=1 size=1 count=1 offset=61944 ["Generated by HyraxBio AB1 generator"] ``` The data is output twice. The first section is the detail, the second is the summary. Selected data types have the "debug data" element populated. e.g. the PBAS (FASTA) ## Generate minimal AB1s from FASTAs To create an AB1 run `hyraxAbif-exe gen "./pathContainingFastas" "./pathForOutputAb1s"` This will create an AB1 per input FASTA ### Input FASTA format Each input data should have the following format ``` > weight read > weight read ``` - The **weight** is a numeric value between 0 and 1 that specifies the weight of the current read. No other header/name is allowed - The **read** is the set of input nucleotides, IUPAC ambiguity codes are supported (MRWSYKVHDBNX). A read can be single or multi-line ### Weighted reads - The weigh of a read specifies the intensity of the peak from 0 to 1. - Weights for each position are added to a maximum of 1 per nucleotide - You can use `_` as a "blank" nucleotide, in which only the nucleotides from other reads will be considered For example ``` > 0.5 ACG > 0.3 AAAA > 1 __AC ``` Results in the following weighted nucleotide per position * 0: `A` (0.5 + 0.3) * 1: `C` (0.5), `A` (0.3) * 2: `G` (0.5), `A` (0.3 + 1 = 1) * 3: `A` (0.3), `C` (1) *Note that the reads do not need to be the same length.* --- #### Example FASTA - single file ***eg1.fasta*** ``` > 1 ACTG ``` ![](docs/docs/eg_actg.png) Here there is a single FASTA with a single read with a weigh of 1 (100%). The chromatogram for this AB1 shows perfect traces for the input `ACTG` nucleotides --- #### Example FASTA - two FASTA files ***eg1.fasta*** ``` > 1 ACAG ``` ***eg2.fasta*** ``` > 1 ACTG ``` ![](docs/docs/eg_acag_acgt.png) Two input FASTA files both with a weigh of 1. You can see in the second trace that the third nucleotide is a `T` (the trace is green). Exactly what the base-calling software (phred & recall etc) decide to call the base as depends on your settings and software choices. --- #### Example FASTA - two FASTA files with different weights ***eg1.fasta*** ``` > 1 ACAG ``` ***eg2.fasta*** ``` > 0.3 ACTG ``` ![](docs/docs/eg_acag_acgt03.png) Here the second fasta has a weight of 0.3 and you can see the traces are 30% of the height of the top ones. --- #### Example FASTA - single FASTA with a mix ***eg1.fasta*** ``` > 1 ACAG > 0.3 ACTG ``` ![](docs/docs/eg_acag_acgt_mix.png) The single input FASTA has an `AT` mix at the third nucleotide. The first read has a weight of 1 and the second a weight of 0.3. Notice that the maximum weight is 1, e.g. the first `A` has the same intensity as the second even though the first one has the reads weighted both 1 and 0.3 --- #### Example FASTA - Multiple mixes ***eg1.fasta*** ``` > 1 ACAG > 0.3 _GT > 0.2 _G ``` ![](docs/docs/eg_multi_mix.png) --- # Using the modules - Hyrax.Abif: The core AB1 types - Hyrax.Abif.Fasta: A simple FASTA parser used when generating AB1s - Hyrax.Abif.Read: Module for parsing an existing AB1 - Hyrax.Abif.Write: Module for writing a new AB1 file - Hyrax.Abif.Generate: Module for generating a minimal AB1 from a given FASTA input For a detailed overview of the code see *TODO* and the haddock documentation *TODO* For now the terminal app (Main.hs) serves as an example and the best starting point to understand the code ## E.g. Add a comment to an existing AB1 file ``` import qualified Hyrax.Abif as H import qualified Hyrax.Abif.Read as H import qualified Hyrax.Abif.Write as H addComment :: IO () addComment = do abif' <- H.readAbif "example.ab1" case abif' of Left e -> putText $ "error reading ABIF: " <> e Right abif -> do let modified = H.addDirectory abif $ H.mkComment "new comment" H.writeAbif "example.modified.ab1" modified ``` For additional examples see the Examples directory