-- | -- Module : ELynx.Data.Sequence.SequenceSpec -- Copyright : (c) Dominik Schrempf 2018 -- License : GPL-3.0-or-later -- -- Maintainer : dominik.schrempf@gmail.com -- Stability : unstable -- Portability : portable -- -- Creation date: Fri Oct 5 14:25:42 2018. module ELynx.Data.Sequence.SequenceSpec ( spec, ) where import qualified Data.ByteString.Lazy.Char8 as L import ELynx.Data.Alphabet.Alphabet import ELynx.Data.Sequence.Sequence import ELynx.Import.Sequence.Fasta import ELynx.Tools import Test.Hspec fastaDifferentLengthFN :: FilePath fastaDifferentLengthFN = "data/NucleotideDifferentLength.fasta" fastaDifferentLengthTrimmedFN :: FilePath fastaDifferentLengthTrimmedFN = "data/NucleotideDifferentLengthTrimmed.fasta" longestSequenceInFileBS :: L.ByteString longestSequenceInFileBS = L.unlines $ map L.pack [">SEQUENCE_3", "ATTTAAAAAAACCCAAAACCCGGGCCCCGGGTTTTTTTA"] longestSequenceInFile :: Sequence longestSequenceInFile = parseByteStringWith "Fasta byte string" (fastaSequence DNA) longestSequenceInFileBS spec :: Spec spec = do describe "longest" $ it "finds the longest sequence" $ do ss <- parseFileWith (fasta DNA) fastaDifferentLengthFN longest ss `shouldBe` longestSequenceInFile describe "filterLongerThan" $ it "filters sequences that are longer than a specified length" $ do ss <- parseFileWith (fasta DNA) fastaDifferentLengthFN ss' <- parseFileWith (fasta DNA) fastaDifferentLengthTrimmedFN filterLongerThan 10 ss `shouldBe` ss'